PHA 6535 Nucleotide Activity Case Study Questions
Assignment ID Number AFFGEHU83939HD Type of Document Essay Writing Format APA/MLA/Harvard Academic Level Masters/University References/Sources 4 References Instructions:
PHA 6535 Nucleotide Activity Case Study Questions
I’m working on a biology multi-part question and need an explanation and answer to help me learn.
Discuss the function in detail of each of the following RNA polymerase II transcription factors.
TFIIB
TFIIE
TFIIF
TFIIH
What additional role does one of the subunits of TFIIH have during the initiation phase that involves other protein kinases? What is the end result?
Discuss in detail how the 5’ cap is formed in eukarytotic mRNAs.
What makes the 3’ end of eukaryotic mRNAs unique? Describe how this is added.
What are the five snRNAs involved in splicing reaction, and describe briefly how they work to assemble spliceosomes.
What step in de novo purine nucleotide synthesis is the first committed step, and what happens in this step? Why is the carboxylation that takes place in step 6 of the de novo purine nucleotide synthesis unusual?
Describe three major feedback mechanisms that help to regulate the overall rate of de novo purine nucleotide synthesis and the relative rates of formation of the two end products, adenylate and guanylate.
How is thymidylate derived?
What causes Lesch-Nyhan Syndrome? What is the role of the enzyme that is lacking in individuals who have this disease?
Describe the condition known as Gout and include in your discussion how it is caused
What effect does the attenuation of hypoxanthine-guanine phosphoribosyl transferase (HGPRT) have on the de novo and salvage syntheses of purines?
Explain in detail the common feature of the biosynthesis of NAD+, FAD and Coenzyme A (CoA)
Define the following terms: codon, reading frame and peptide sequence (3 points)
Review the following coding DNA Sequence and its template strand, and provide the sequence
for the corresponding mRNA strand in 5’ to 3’ orientation: (2 points)
5’-CCGGCTAAGATCTGACTAGC-3’ (coding)
3’-GGCCGATTCTAGACTGATCG-5’ (template)Provide the 3 possible reading frames for the following mRNA sequence and identify any initiation
or termination codons (5 points)
5’- GCUAGUCAGAUCUUAGCCGG -3’Consider the following mRNA sequence, translate each codon into its corresponding amino acid
and provide the peptide sequence: (5 points)
5’-CGG CUA AGA UCU GAC UAG -3’
RUBRIC
QUALITY OF RESPONSE NO RESPONSE POOR / UNSATISFACTORY SATISFACTORY GOOD EXCELLENT Content (worth a maximum of 50% of the total points) Zero points: Student failed to submit the final paper. 20 points out of 50: The essay illustrates poor understanding of the relevant material by failing to address or incorrectly addressing the relevant content; failing to identify or inaccurately explaining/defining key concepts/ideas; ignoring or incorrectly explaining key points/claims and the reasoning behind them; and/or incorrectly or inappropriately using terminology; and elements of the response are lacking. 30 points out of 50: The essay illustrates a rudimentary understanding of the relevant material by mentioning but not full explaining the relevant content; identifying some of the key concepts/ideas though failing to fully or accurately explain many of them; using terminology, though sometimes inaccurately or inappropriately; and/or incorporating some key claims/points but failing to explain the reasoning behind them or doing so inaccurately. Elements of the required response may also be lacking. 40 points out of 50: The essay illustrates solid understanding of the relevant material by correctly addressing most of the relevant content; identifying and explaining most of the key concepts/ideas; using correct terminology; explaining the reasoning behind most of the key points/claims; and/or where necessary or useful, substantiating some points with accurate examples. The answer is complete. 50 points: The essay illustrates exemplary understanding of the relevant material by thoroughly and correctly addressing the relevant content; identifying and explaining all of the key concepts/ideas; using correct terminology explaining the reasoning behind key points/claims and substantiating, as necessary/useful, points with several accurate and illuminating examples. No aspects of the required answer are missing. Use of Sources (worth a maximum of 20% of the total points). Zero points: Student failed to include citations and/or references. Or the student failed to submit a final paper. 5 out 20 points: Sources are seldom cited to support statements and/or format of citations are not recognizable as APA 6th Edition format. There are major errors in the formation of the references and citations. And/or there is a major reliance on highly questionable. The Student fails to provide an adequate synthesis of research collected for the paper. 10 out 20 points: References to scholarly sources are occasionally given; many statements seem unsubstantiated. Frequent errors in APA 6th Edition format, leaving the reader confused about the source of the information. There are significant errors of the formation in the references and citations. And/or there is a significant use of highly questionable sources. 15 out 20 points: Credible Scholarly sources are used effectively support claims and are, for the most part, clear and fairly represented. APA 6th Edition is used with only a few minor errors. There are minor errors in reference and/or citations. And/or there is some use of questionable sources. 20 points: Credible scholarly sources are used to give compelling evidence to support claims and are clearly and fairly represented. APA 6th Edition format is used accurately and consistently. The student uses above the maximum required references in the development of the assignment. Grammar (worth maximum of 20% of total points) Zero points: Student failed to submit the final paper. 5 points out of 20: The paper does not communicate ideas/points clearly due to inappropriate use of terminology and vague language; thoughts and sentences are disjointed or incomprehensible; organization lacking; and/or numerous grammatical, spelling/punctuation errors 10 points out 20: The paper is often unclear and difficult to follow due to some inappropriate terminology and/or vague language; ideas may be fragmented, wandering and/or repetitive; poor organization; and/or some grammatical, spelling, punctuation errors 15 points out of 20: The paper is mostly clear as a result of appropriate use of terminology and minimal vagueness; no tangents and no repetition; fairly good organization; almost perfect grammar, spelling, punctuation, and word usage. 20 points: The paper is clear, concise, and a pleasure to read as a result of appropriate and precise use of terminology; total coherence of thoughts and presentation and logical organization; and the essay is error free. Structure of the Paper (worth 10% of total points) Zero points: Student failed to submit the final paper. 3 points out of 10: Student needs to develop better formatting skills. The paper omits significant structural elements required for and APA 6th edition paper. Formatting of the paper has major flaws. The paper does not conform to APA 6th edition requirements whatsoever. 5 points out of 10: Appearance of final paper demonstrates the student’s limited ability to format the paper. There are significant errors in formatting and/or the total omission of major components of an APA 6th edition paper. They can include the omission of the cover page, abstract, and page numbers. Additionally the page has major formatting issues with spacing or paragraph formation. Font size might not conform to size requirements. The student also significantly writes too large or too short of and paper 7 points out of 10: Research paper presents an above-average use of formatting skills. The paper has slight errors within the paper. This can include small errors or omissions with the cover page, abstract, page number, and headers. There could be also slight formatting issues with the document spacing or the font Additionally the paper might slightly exceed or undershoot the specific number of required written pages for the assignment. 10 points: Student provides a high-caliber, formatted paper. This includes an APA 6th edition cover page, abstract, page number, headers and is double spaced in 12’ Times Roman Font. Additionally, the paper conforms to the specific number of required written pages and neither goes over or under the specified length of the paper.
GET THIS PROJECT NOW BY CLICKING ON THIS LINK TO PLACE THE ORDER
CLICK ON THE LINK HERE: https://termhomework.com/orders/ordernow
You Can Also Place the Order In www.termhomework.com/orders/ordernow / www.essaysolver.com/orders/ordernow
Do You Have Any Other Essay/Assignment/Class Project/Homework Related to this? Click Here Now [CLICK ME]and Have It Done by Our PhD Qualified Writers!!
PHA 6535 Nucleotide Activity Case Study Questions
Tired of getting an average grade in all your school assignments, projects, essays, and homework? Try us today for all your academic schoolwork needs. We are among the most trusted and recognized professional writing services in the market.
We provide unique, original and plagiarism-free high quality academic, homework, assignments and essay submissions for all our clients. At our company, we capitalize on producing A+ Grades for all our clients and also ensure that you have smooth academic progress in all your school term and semesters.
High-quality academic submissions, A 100% plagiarism-free submission, Meet even the most urgent deadlines, Provide our services to you at the most competitive rates in the market, Give you free revisions until you meet your desired grades and Provide you with 24/7 customer support service via calls or live chats.